|
|
||||||||
Department of Pathology and Laboratory Medicine and Jonsson Comprehensive Cancer Center, School of Medicine, University of California, Los Angeles, CA 90095
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
It is becoming increasingly apparent that signals of extramedullary
origin also affect normal B cell development, and hormones derived from
various endocrine tissues are important in this regard
(13). For example, B cell development in pregnant mice is
suppressed by elevated estrogen levels (14). Conversely,
other studies have revealed that hormones produced by the thyroid gland
act as obligate, positive regulators of primary B lymphopoiesis
(15, 16). This latter conclusion is based on the
examination of B lymphopoiesis in several strains of mice deficient in
the production of one or more anterior pituitary-derived hormones due
to naturally occurring or induced genetic defects (16, 17). These studies revealed that, whereas B lymphopoiesis is
normal in animals with defective production of growth hormone,
insulin-like growth factor-I, or prolactin, the frequency and absolute
number of B lineage cells is significantly decreased only in thyroid
hormone-deficient strains. For example, hypothyroid
(hyt/hyt) mice produce
10% of normal thyroid hormone
levels due to the inability of thyroid epithelial cells to bind
thyroid-stimulating hormone (18, 19, 20). The frequency of B
lineage cells was reduced by up to 70% in hyt/hyt mice, and
this deficiency could be completely corrected by administration of
thyroxine (T4) (16). These hemopoietic defects in thyroid
hormone-deficient mice only affect cell production in the B lineage,
given that no significant differences in myeloid cell frequencies or
numbers were observed (16).
The mechanism(s) responsible for the specific decrease in the production of B lineage cells in hyt/hyt mice has not been defined. Thyroid hormones have been shown to regulate cell proliferation, differentiation, and death during embryogenesis and postnatal life (reviewed in 21), and normal B cell development is dependent on the coordination of all of these processes. For example, the most immature B cell precursors, referred to as pro-B cells, proliferate extensively in the bone marrow to maintain the size of the pro-B cell pool and to generate progeny that will differentiate into Ig-expressing cells (6, 22, 23). The latter event is dependent on the successful recombination of genes that encode the Ig molecule, and those B lineage precursors that are not successful at doing so undergo apoptosis and are eliminated from the bone marrow. Thus, the ultimate production of a B lymphocyte is a dynamic process involving cell growth, cell maturation, and cell death (5, 8, 24, 25, 26), and the tempo of any one of these events could be negatively impacted by the absence of thyroid hormones.
To determine how thyroid hormones affect B lymphopoiesis, various B cell developmental processes were examined in hyt/hyt mice. The results of these analyses indicate that the frequency of proliferating pro-B cells is reduced in that strain and that treatment of the mice with thyroxine increased both the frequency and total number of cycling pro-B cells. Taken together with the results of additional in vitro assays demonstrating that the number of B lineage cells is increased in the presence of thyroid hormones, these data suggest that products of the pituitary/thyroid axis regulate the proliferative potential of developing B cell precursors.
| Materials and Methods |
|---|
|
|
|---|
BALB/c BJ (BALB/c), C.RF-hyt/hyt, and C.RF-+/? (which are either hyt/+ or +/+) mice were obtained from The Jackson Laboratory (Bar Harbor, ME). The hyt/hyt mice were 8 to 12 wk of age and had been removed from normal littermates for at least 2 wk before the experiment to eliminate potential hormonal effects transferred to them. All of the mice were housed in microisolator cages under laminar flow conditions in the Division of Laboratory Animal Medicine vivarium at UCLA.
In some experiments, mice received an i.v. injection of 150 mg/kg 5-fluorouracil (5-FU,2 Sigma, St. Louis, MO (2, 27)) 8 days before analysis. In addition, some of the 5-FU-treated animals received a daily s.c. injection of 2 µg of DL-thyroxine (T4; T-0881; Sigma) or saline for 8 days. T4 was used for these studies because it is more stable and has a longer duration of in vivo activity than triiodothyronine (T3) (28).
Preparation of cell suspensions
Mice were killed by cervical dislocation. A single-cell
suspension of bone marrow cells was obtained by flushing femurs and
tibiae with 3 ml
-MEM (Life Technologies, Grand Island, NY). Cells
were counted in a hemacytometer, and cell viability, determined by
eosin dye exclusion, always exceeded 95%.
Immunofluorescence
Bone marrow cells were incubated with the following Abs:
FITC-conjugated anti-IgM (Southern Biotechnology, Birmingham, AL),
FITC-conjugated heat-stable Ag (HSA), PE-conjugated anti-CD45R
(B220, clone RA3-6B2), biotin-conjugated anti-CD43 (clone S7), or
FITC-conjugated anti-CD25 (clone 7D4; PharMingen, San Diego, CA).
Biotinylated Abs were revealed with FITC-conjugated streptavidin
(Southern Biotechnology). After RBC lysis by osmotic shock, samples
were incubated with an anti-murine Fc
II and III receptor Ab
(CD16/32, clone 2.4G2, PharMingen) to reduce nonspecific labeling
before the addition of one or more of the above Abs. All stainings were
conducted in Ca2+-,
Mg2+-free PBS (Life Technologies) on ice. After
the last wash, 104 cells from each sample were
analyzed on a FACScan (Becton Dickinson, San Jose, CA) with CELL Quest
software (Becton Dickinson).
Enrichment of CD45R+ cells
Bone marrow CD45R+ cells were enriched by using a magnetic activated cell sorter column (Miltenyi Biotec, Auburn, CA) according to the manufacturers protocol. Briefly, after incubation with anti-CD32/CD16 Ab, cells were incubated with anti-murine CD45R-conjugated superparamagnetic beads in Ca2+-, Mg2+-free PBS, 5 mM EDTA, 0.5% BSA, pH 7.2 (all from Sigma) for 25 min at 68°C under constant agitation. The cells were then washed and loaded on the magnetic activated cell sorter column placed in its magnetic support. The column was rinsed with 3 to 4 times the column volume to remove the negative cells, and the positive fraction was eluted from the column after its removal from the magnetic support. CD45R+ cell enrichment ranged from 60 to 95% depending on the experiment.
In some experiments, CD45R+sIgM- cells were purified on a FACStarPlus cell sorter (Becton Dickinson) after incubations with FITC-anti-IgM and PE-anti-CD45R Abs.
Incubation with anti-murine CD45R-conjugated superparamagnetic beads or fluorochromes did not interfere with subsequent immunofluorescence analysis or in vitro culture experiments (data not shown).
Cell cycle analysis
Cells were fixed in 0.5% paraformaldehyde for 15 min at room temperature. The cells were then permeabilized with 70% ethanol and resuspended in Ca2+-, Mg2+-free PBS supplemented with 1 µg/ml 7-amino actinomycin D (7-AAD) (Calbiochem, San Diego, CA). At least 3 x 104 cells were acquired with a FACScan, and their cycling status was estimated using Modfit LT software (Verity Software House, Topsham, ME). The coefficient of variation for the G0/G1 peak obtained during these analyses was on average <5%.
Detection of apoptotic cells
Apoptotic cells were detected by their increased permeability to the DNA dye 7-AAD (29). After immunostaining for CD45R, CD43, and/or IgM expression, 5 x 105 CD45R+ or cultured bone marrow cells were incubated with 1 µg/ml 7-AAD in Ca2+, Mg2+ free PBS. Following 1530 min incubation, cells were analyzed on a FACScan equipped with a double discrimination module. Gates were set on the basis of staining with secondary reagent alone. Dead cells were excluded based on their forward and side scatter profile. Apoptosis was analyzed with CELL Quest software (Becton Dickinson).
Apoptotic cells were also detected by annexin V staining (R&D Systems, Minneapolis, MN). Following immunostaining for CD45R expression, 3 x 105 cells were resuspended in binding buffer (10 mM HEPES/NaOH, pH 7.4, 140 mM NaCl, and 2.5 mM CaCl2) and incubated with FITC-conjugated annexin V for 15 min at room temperature in the dark according to the manufacturers instructions.
Long term bone marrow cultures
Long term myeloid cultures were established as described (30). After 4 wk, these cultures were switched to B lymphoid-permissive conditions (31, 32). At the time of switch and at each weekly feeding thereafter, the culture medium was supplemented with 10-8 M T3 or saline. T3 was used in these studies because it was not clear that all the requirements for conversion of T4 to T3, the most active form of the hormone (28), would be present in the cultures. Cells harvested from at least three cultures per condition were analyzed weekly for emergence of CD45R+sIgM- and sIgM+ cells by immunofluorescence.
RT-PCR and Southern blot analysis
Subpopulations of bone marrow B lineage cells from BALB/c mice
were purified into fraction A (HSA-,
CD45R+, CD43+), fraction B
+ C (HSA+, CD45R+,
CD43+), fraction D (CD45R+,
CD43-, sIgM-), and
Fraction E + F (CD45R+,
CD43-, sIgM+) based on the
protocol described by Hardy et al. (6) on a FACSadvantage
in the UCLA flow cytometry core facility. After sorting, mRNA was
prepared according to the manufacturers directions (Pharmacia
Biotech, Piscataway, NJ) and was reverse-transcribed into cDNA with the
use of the same number of cells from each sorted fraction. The cDNA was
amplified with the following primers. thyroid hormone receptor (TR)
gene common 5'-primer, CGCAAGCTGATTGAGCAGAAC; TR
1,
3'-AGCCACTTCCGTGTCATCCAG (549 bp). TR
2, 3'-AGCAGCTCCAGGAGACGCTGC
TGC (933 bp). TRß gene common 3'-primer,
ACAGAGCTCATCTTTGTCTAAATAG (33); TRß1,
5'-GGTGGTACCAAGTTCCACACATG (410 bp). TRß2,
5'-GGTTATTCATCCCCTCTCTTGTTTCATGTGTATG (480 bp). GAPDH primers
5'-CCATGGAGAAGGCTGGGG and 3'-CAAAGTTGTCATGGATGACC (200 bp) were
also used to ensure DNA integrity.
PCR amplification was performed in a final volume of 100 µl
containing 10 mM Tris-HCl (pH 8.3); 2.5 mM, 1.5 mM, and 3.5 mM
MgCl2 for TR
1, TR
2, and TRß1/2,
respectively; 600 µM concentrations each of the dATP, dGTP, dUTP, and
TTP; 1.0 µM concentrations of the primers; 50 mM KCl; and 2.5 U
Taq polymerase (Perkin-Elmer Cetus, Norwalk, CT). Cycles,
repeated 3035 times, consisted of 1 min of denaturation at 94°C; 1
min annealing at 59°C for TR
1, TRß1, TRß2, and GAPDH and at
63°C for TR
2; and 1 min of polymerization at 72°C. The final
polymerization step was extended an additional 15 min. A Perkin-Elmer
Thermal Cycler was used for all reactions. PCR fragments were
transferred to nylon membranes as described (34) and
detected with murine TR
1, TR
2, TRß1, and TRß2 radioactive
probes.
Proliferation assay
Sorted CD45R+sIgM- cells (105/well) were distributed in 96-well plates, either over irradiated confluent S17 stromal cells (35) or without stroma, in Iscoves medium (Life Technologies) supplemented with 5% FBS and L-glutamine (Life Technologies) and incubated for 3 days in a humidified incubator at 37°C and 5% CO2/air. Some wells were additionally supplemented with 10-8 M T3 and/or 50 U/ml recombinant murine IL-7 (Biosource International, Camarillo, CA). A parallel set of cultures was also established with FBS from which 85% of the T3 and 92% of T4 had been depleted (36), as confirmed by RIA performed in the UCLA Department of Pathology Clinical Laboratories (data not shown). Cultures were then pulsed with 1 µCi/well [methyl-3H]thymidine during the last 16 h of culture, and specific incorporation by the cells was determined.
Statistics
Data were analyzed using a single-tailed Student t test.
| Results |
|---|
|
|
|---|
The data in Fig. 1
show, in
agreement with previously published results (16), that the
frequency of CD45R+ IgM-
pro/pre-B and surface IgM+ B cells is lower in
hyt/hyt mice than in their normal +/? littermates. The
absolute number of B lineage cells is also lower in the
hormone-deficient mice (Ref. 16 and data not shown).
|
An increased rate of apoptosis could explain the decreased number and frequency of B lineage cells in hyt/hyt mice. To investigate this possibility, the frequency of apoptotic hyt/hyt and +/? bone marrow B lineage cells was determined by measuring membrane permeability to 7-AAD. Attempts were made in initial experiments to assess the frequency of apoptosis in B lineage cells in unfractionated hyt/hyt bone marrow, but the low numbers of pro-B/pre-B cells in that strain made this analysis difficult. Therefore, CD45R+ cells from the bone marrow of hyt/hyt mice were enriched on a magnetic column before analysis in subsequent experiments.
Large CD45R+sIgM- cells
are the B lineage population with the highest incidence of apoptosis
(37). Because cells with these physical and phenotypic
characteristics are included in the
CD45R+CD43+ pro-B cell
population (38), initial experiments focused on defining
the frequency of apoptotic cells in that compartment. As shown in Table I
, the frequency of apoptotic
CD45R+CD43+ pro-B cells in
hyt/hyt and +/? mice was comparable. A similar conclusion
was reached when the analysis was performed on
sIgM+ B cells, which have the next highest
incidence of apoptosis (37), and
CD45R+sIgM- cells or when
the same analyses were repeated using propidium iodide staining to
detect hypodiploid DNA (data not shown).
|
Bone marrow B lineage cells from hyt/hyt mice show a reduced proliferative capacity
To determine whether thyroid hormone deficiency affects the proliferative status of B lineage cells in hyt/hyt mice, their cycling status was examined. Similar to what was encountered in the apoptosis studies, attempts to assess the frequency of S-G2/M phase B lineage cells in unfractionated hyt/hyt bone marrow were unsuccessful due to the low numbers of pro-B/pre-B cells (data not shown). Because most cycling B lineage cells are found in the pro-B cell compartment (6, 22), in subsequent studies hyt/hyt and +/? bone marrow cells were labeled with a combination of Abs that would permit the cycling status of enriched CD45R+CD43+ pro-B cells to be assessed.
The data in Table II
show results from
three experiments in which the cell cycle status of these enriched
CD45R+CD43+ pro-B cells
from hyt/hyt mice and their +/? littermates was compared. A
consistent finding in all three experiments was that the frequency of
pro-B cells in the S-G2/M phase of the cell cycle
was significantly lower in hyt/hyt mice than in their +/?
littermates. In agreement with Hardy et al. (6), the
frequency of S-G2/M phase
CD45R+ CD43- pre-B and B
cells was comparatively lower, and no significant differences were
observed in the cycling status of these populations in
hyt/hyt and +/? mice. For example, in one representative
study, 5.9% of hyt/hyt and 4.8% of +/?
CD45R+CD43- cells were in
the S-G2/M phase of the cell cycle.
|
Bone marrow pro-B cells from 5-FU-treated hyt/hyt mice show a reduced proliferative capacity
The above results strongly suggest that the proliferative potential of pro-B cells is compromised in hyt/hyt mice. To accentuate this defect, de novo pro-B cell proliferation was induced by treating the mice with the cytostatic drug 5-FU. After treatment, cycling bone marrow cells are eliminated (27, 40), and resting immature hemopoietic progenitors are driven into cell cycle to replenish the myeloid and lymphoid compartments in the marrow. Whether or not hyt/hyt mice would also show a pro-B cell proliferation defect in this model was thus investigated.
Fig. 2
shows a representative experiment
demonstrating that the frequency of cycling
CD45R+CD43+ pro-B cells in
5-FU-treated hyt/hyt mice (84.5%) was significantly lower
than in their +/? littermates (96.2%) 8 days after 5-FU treatment. The
latter time point was chosen based on a report showing that at 8 days
post-5-FU treatment, immature hemopoietic progenitors are actively
cycling (41), and preliminary experiments in which the
cell cycle status of bone marrow from 5-FU-treated mice was examined at
different times after drug injection (data not shown). Similar results
were also obtained in two additional experiments (Table III
).
|
|
Thyroxine treatment increases the number of cycling pro-B cells in hyt/hyt mice
To determine whether thyroid hormones could increase the frequency
of cycling pro-B cells in hyt/hyt mice, animals were treated
daily with either T4 or saline for 8 days after 5-FU injection. As
shown in Table IV
, T4 treatment increased
the frequency of cycling
CD45R+CD43+ cells in
5-FU-treated hyt/hyt mice by up to 10%. In one experiment
(Fig. 3
), 70.8% of
CD45R+CD43+ cells were in
cycle in the saline-treated mice, whereas 81% of the pro-B cells were
in S-G2/M in the T4-treated group. In addition to
the increase in the frequency of S-G2/M pro-B
cells, T4 treatment also resulted in a significant increase in the
absolute number of cycling pro-B cells. This effect was paralleled by
increases in the frequency and absolute number of total pro-B cells
(Table IV
).
|
|
Thyroid hormones have direct effects on the bone marrow
To examine whether thyroid hormones can directly affect the bone
marrow, the biologically active form of thyroid hormone, T3, was added
to myeloid long term bone marrow cultures at the time of their transfer
to B lymphoid-permissive conditions (32). In this system,
myelopoiesis declines and B lymphopoiesis initiates and plateaus at 4
wk after transfer to the lymphoid culture conditions. As shown in Fig. 4
, the kinetics of when B lineage cells
emerge in the cultures was not affected by the addition of T3 to the
cultures. However, between weeks 1 and 3, the period during which the
transition from myelopoiesis to B lymphopoiesis occurs, the frequency
and absolute number of
CD45R+sIgM- cells were
significantly increased in the T3-supplemented cultures (Fig. 4
and
Table V
).
|
|
In view of the ability of thyroid hormones to affect bone marrow B
lymphopoiesis, the expression of TRs was examined on subpopulations of
bone marrow B lineage cells by RT-PCR and Southern blot analysis. TRs
are expressed from two genes,
and ß, and both produce different
isoforms due to alternative splicing events (42, 43, 44). As
shown in Fig. 5
, TR
1 and TRß1 were
constitutively expressed throughout B cell development, whereas TRß2
was not detected. On the other hand, TR
2 was detected in fractions
AC, down-regulated in fraction D, and up-regulated in fraction E
+ F.
|
The expression of the TR on bone marrow pro-B cells provided the
rationale for assessing whether or not thyroid hormones had direct
effects on cells in that compartment. Purified
CD45R+sIgM- bone marrow
cells from hyt/hyt mice were cultured with
10-8 M T3 for 72 h. Because
hyt/hyt cells were "maintained" in a thyroid
hormone-deficient environment, it was reasoned that hormone effects
would be more demonstrable on these targets than on similar cell
populations from normal animals. As shown in Fig. 6
, T3 did not stimulate proliferation of
CD45R+sIgM- cells in
medium containing FBS or thyroid hormone-depleted FBS in cultures
analyzed at 3 and 7 (data not shown) days postinitiation. However,
cells cultured in either of these conditions exhibited vigorous
proliferation in response to the pro-B cell growth factor IL-7. No
proliferative effects of T3 were noted when cultures were examined at
24 and 48 h (data not shown).
|
Finally, additional experiments were performed in which sorted CD45R+sIgM- cells from hyt/hyt mice were seeded over irradiated S17 stromal cells in the presence of IL-7 alone, T3 alone, or IL-7 + T3 for 13 days. T3 again had no effect on cell proliferation under these conditions (data not shown).
| Discussion |
|---|
|
|
|---|
Reduced concentrations of thyroid hormones in hyt/hyt mice could compromise B lymphopoiesis through effects on the differentiation, survival, and/or proliferation of B lineage cells. Although the actions of thyroid hormones on the differentiation of B cell progenitors cannot be excluded, such an effect seems unlikely because all stages of B lymphopoiesis are present in hyt/hyt mice. Furthermore, the frequency of the most immature, committed CD45R+CD43+HSA- B cell precursors (Hardy fraction A) is comparable in hyt/hyt mice and their +/? littermates (16), suggesting that the differentiation of pluripotential stem cells and/or lymphoid stem cells into the B cell lineage is not compromised. Therefore, it was logical to propose that the deficiency of B lineage cells in the absence of thyroid hormone was caused by a decrease in survival or proliferation of committed B cell precursors. No evidence to support a role for thyroid hormones in the survival of B lineage cells was obtained in this study. Even though multiple techniques allowing detection of cells at early and late stages of apoptosis were used, no differences in the frequency of apoptotic B lineage cells between hyt/hyt mice and their normal littermates were revealed. Therefore, subsequent experiments focused on whether or not thyroid hormones could affect the proliferation of B cell progenitors.
In the first set of experiments, the cell cycle status of
CD45R+CD43+ pro-B cells in
hyt/hyt mice was compared with that in their +/? littermates. The pro-B
cell compartment was the focus of these studies because B cell
progenitors with the highest rate of proliferation are included in it
(6), and no differences in the frequency of cycling
CD45R+CD43- (pre-B and B)
cells in hyt/hyt and +/? mice were observed. The data
demonstrated a requirement for thyroid hormones in pro-B cell
proliferation. On average, 23.8% of
CD45R+CD43+ cells in
hyt/hyt mice were in cycle, whereas in the +/? littermates
29% were in the S-G2/M phase of the cell cycle.
The expression of the CD25 cell surface determinant was used to
delineate at which pro-B cell stage the proliferative defect in
hyt/hyt mice occurred. The results showed that there was no
difference in the frequency of proliferating
CD25+ pro-B cells between hyt/hyt mice
and their normal littermates, suggesting that fractions A, B, and early
C were affected by the absence of thyroid hormone. The pro-B cell
compartment is estimated to contain
1 million cells
(45) that are capable of both differentiation into pre-B
cells and self-renewal and that, together, maintain the pro B-cells
pool at a constant size. The decreased proliferation of pro-B cells in
hyt/hyt mice apparently has profound consequences over time,
as substantiated by the significantly lower frequency and absolute
numbers of cells in that compartment and on the size of more mature,
downstream populations.
This working hypothesis is consistent with the results of Arpin and
colleagues who have shown that mice with a targeted disruption of the
TR also have a defect in pro/pre-B cell proliferation (C. Arpin and
J. Marvel, unpublished observations). Thus, whereas the data herein
document a pro-B cell proliferation defect in animals with deficient
production of thyroid hormones (the ligand), a similar deficiency has
been observed in mice with aberrant receptor expression.
To make the requirement for thyroid hormones in pro-B cell
proliferation more evident, subsequent experiments in which mice were
treated with 5-FU were conducted. In general, the frequency of
CD45R+CD43+ bone marrow
pro-B cells in the 5-FU-treated hyt/hyt and +/? mice was
markedly higher than in their respective saline treated controls or in
unmanipulated mice. This result is likely due to the fact that few
mature cells are present in the marrow 8 days after 5-FU treatment;
there is thus a relative increase in the frequency, and possibly the
absolute number, of the pro-B cells. In any case, this model provides a
regenerative challenge to which B cell progenitors would not normally
be subjected. As expected, the 5-FU treatment accentuated the
proliferative deficiency of B lineage cells in hyt/hyt mice,
because the average frequency of pro-B cells in the
S-G2/M phases of the cell cycle was
10% lower
than in their +/? littermates.
To confirm that the lower frequency of cycling cells in the 5-FU-treated hyt/hyt mice was a result of thyroid hormone deficiency, additional groups of mice were treated with T4 after 5-FU administration. Consistent with its proposed role as a regulator of pro-B cell proliferation, the frequency of cycling CD45R+CD43+ pro-B cells in T4-treated hyt/hyt mice was on average 8% above that in saline-treated hyt/hyt animals. Additionally, the absolute number of cycling pro-B cells in hyt/hyt mice treated with T4 was significantly higher than that in saline-treated mice. These results appear to explain why the frequency of B lineage cells was significantly increased in the T4-treated mice.
The increase in the frequency and absolute number of B lineage cells in the 5-FU/T4-treated hyt/hyt mice was accompanied by a decline in the frequency of CD45R- cells. In one of these experiments, this decline in the frequency of CD45R- cells was paralleled by a lower frequency of proliferating CD45R- cells, which are presumably myeloid (data not shown). There is a well-established, reciprocal relationship between B lymphopoiesis and myelopoiesis (46), so these results are not surprising. Thus, as the number of B lineage cells increased as a result of T4 treatment, there was a proportionate decline in the number of myeloid cells. One possible explanation for this observation is that thyroid hormones might act, not by stimulating B lymphopoiesis, but by inhibiting the growth and/or differentiation of myeloid cells. This seems unlikely for two reasons. First, the addition of T3 to myeloid long term bone marrow cultures had no effect on cell production (data not shown). Additionally, exogenous thyroid hormone had no effect on the number of myeloid colonies generated in response to GM-CSF (data not shown). Taken together, these observations strongly suggest that the decline in the frequency and cycling status of CD45R- cells in T4-treated hyt/hyt mice is not due to direct suppressive effects of thyroid hormones on non-B lineage cells.
To determine the potential for thyroid hormones to affect B lymphopoiesis through direct effects on the bone marrow, T3 was added to long term bone marrow cultures. In these experiments, the kinetics of the emergence of pre-B and B cells in the cultures was not affected. This result is consistent with the previous suggestion that thyroid hormones do not affect pro-B cell differentiation. However, the frequency and absolute number of B lineage cells were significantly higher in T3-supplemented cultures. Although these results do not exclude extramedullary actions of thyroid hormones, the data clearly demonstrated that at least some effects of thyroid hormones are directly mediated on the bone marrow. In addition, they support the observation that thyroid hormone stimulates proliferation of B lineage cells.
In view of these results, further studies were conducted to determine
whether or not thyroid hormone affected B lineage cells directly.
Initial experiments assessed whether or not the TR was expressed during
B lymphopoiesis. TRs are members of a family of ligand-dependent,
zinc-finger transcription factors (47, 48). They are
encoded by two genes,
and ß, and alternative splicing produces
receptor isoforms. All TRs have DNA-binding domains, and except for
TR
2, ligand-binding domains (49). Upon binding ligand,
the receptor/ligand complex then binds DNA and activates gene
expression. On the other hand, TR
2 cannot bind thyroid hormone, but
it can still bind DNA and thus acts as a dominant-negative form of the
receptor (50). Additionally, TR
2 has been shown to
interfere with transcription activation of the active ligand-binding
forms of the receptor (51, 52).
Published results have shown that TR
mRNA is expressed in chicken
bone marrow cells (53) and murine B cell lines
(54), but there have been no reports detailing TR
expression during each stage of B lymphopoiesis. RT-PCR and Southern
blot analysis showed that TR
1 and TRß1 were constitutively
expressed throughout B cell development, whereas TRß2 was not
detected. The absence of TRß2 expression was not surprising because
it has only been detected in the anterior pituitary and the brain
(55, 56). The most striking result of this experiment was
the differential regulation of TR
2 during B lymphopoiesis. The
results show that TR
2 is expressed in fractions AC, down-regulated
at fraction D, and then up-regulated at fraction E + F. Interestingly,
thyroid hormone-deficient mice have the greatest decrease in cell
frequency and absolute number in fraction D (15). Whether
the down-regulation of TR
2 during the fraction C to D transition is
relevant to the dramatic cell loss at fraction D in thyroid
hormone-deficient mice is currently being investigated.
The results of the long term culture experiments and the data showing
that pro-B cells express TRs
and ß provided a rationale for
experiments to demonstrate a direct effect of T3 on B lineage cells.
However, attempts to do so were unsuccessful. T3 did not stimulate the
proliferation of sorted
CD45R+sIgM- B lineage
cells in vitro, nor did it act as an IL-7 proliferation cofactor. Taken
together, the inabilities to demonstrate direct growth-promoting
effects or IL-7 cofactor activity suggest that thyroid hormones
regulate the size of the pro-B cell compartment in an as yet
uncharacterized manner.
The challenge will be to determine at the molecular level how thyroid hormones regulate pro-B cell growth. Thyroid hormone acts through its TRs to regulate gene expression (28). In the ligand-bound form, the TRs can activate transcription, whereas in the unbound form, they can repress it (57). Reduced levels of thyroid hormone could thus affect gene regulation by down-regulating expression of thyroid hormone-responsive genes. If these included genes that encoded cyclins and/or cyclin-dependent kinases in early B precursors, their proliferation could be compromised. Alternatively, the TR/thyroid hormone complex may control expression of regulatory proteins that in turn modulate the expression of molecules that inhibit the function of cell cycle proteins. For example, studies have shown that depletion of thyroid hormone inhibited proliferation of human glioblastoma cells and arrested them in G1 through up-regulation of p21, an inhibitor of cyclin-dependent kinases (58). Further studies will be needed to investigate whether a similar effect occurs in pro-B cells. Nevertheless, the data in this report provide an explanation for the decreased frequency of B lineage cells observed in thyroid hormone-deficient mice and further establish a role of the pituitary/thyroid axis in B cell development.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Abbreviations used in this paper: 5-FU, 5-fluorouracil; T4, DL-thyroxine; T3, triiodothyronine; HSA, heat-stable Ag; TR, thyroid hormone receptor; 7-AAD, 7-amino actinomycin D. ![]()
3 Address correspondence and reprint requests to Dr. Kenneth Dorshkind, Division of Pathology and Laboratory Medicine-173216, University of California, Los Angeles, 10833 Le Conte Avenue, Los Angeles, CA 90095. E-mail address: ![]()
Received for publication March 29, 1999. Accepted for publication July 16, 1999.
| References |
|---|
|
|
|---|
chain transmits distinct signals for proliferation and differentiation during B lymphopoiesis. EMBO J. 15:1924.[Medline]
gene encoding a thyroid hormone receptor is essential for post-natal development and thyroid hormone production. EMBO J. 16:4412.[Medline]
and ß thyroid hormone receptors from thyrotrope cells: the mouse pituitary-specific ß2 isoform differs at the amino terminus from the corresponding species from rat pituitary tumor cells. Mol. Endocrinol. 5:1049.[Medline]
L chain gene rearrangements and c-kit and IL-7 receptor expression in stromal cell-dependent pre-B cells. J. Immunol. 149:1973.[Abstract]
chain (CD25, TAC) expression defines a crucial stage in pre-B cell development. Int. Immunol. 6:1257.
and N-terminal variant ß receptors. Development 114:39.[Abstract]
-related protein which binds deoxyribonucleic acid but does not bind thyroid hormone. Mol. Endocrinol. 2:893.[Medline]
2: role of the ninth heptad in DNA binding, heterodimerization with retinoid X receptors, and dominant negative activity. J. Biol. Chem. 271:28235.
-type c-erbA inhibits trans-activation by thyroid hormone receptors without binding thyroid hormone. Proc. Natl. Acad. Sci USA 86:7771.
and ß thyroid hormone receptor genes. EMBO J. 9:1519.[Medline]
, in B lymphocytes: alternative mRNA processing is independent of differentiation but correlates with antisense RNA levels. Nucleic Acids Res. 25:4296.
and ß thyroid hormone receptor genes in rat brain and pituitary. Proc. Natl. Acad. Sci USA 86:7250.This article has been cited by other articles:
![]() |
J. R. Klein The immune system as a regulator of thyroid hormone activity. Experimental Biology and Medicine, March 1, 2006; 231(3): 229 - 236. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Jacenko, D. W. Roberts, M. R. Campbell, P. M. McManus, C. J. Gress, and Z. Tao Linking Hematopoiesis to Endochondral Skeletogenesis through Analysis of Mice Transgenic for Collagen X Am. J. Pathol., June 1, 2002; 160(6): 2019 - 2034. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Montecino-Rodriguez, H. Leathers, and K. Dorshkind Expression of connexin 43 (Cx43) is critical for normal hematopoiesis Blood, August 1, 2000; 96(3): 917 - 924. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Dorshkind and N. D. Horseman The Roles of Prolactin, Growth Hormone, Insulin-Like Growth Factor-I, and Thyroid Hormones in Lymphocyte Development and Function: Insights from Genetic Models of Hormone and Hormone Receptor Deficiency Endocr. Rev., June 1, 2000; 21(3): 292 - 312. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||